Sequence ID | >CHL1810032228 |
Genome ID | KX180090 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Parinari capensis (KX180090) |
Start position on genome | 160121 |
End posion on genome | 160195 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccccgctaa |
tRNA gene sequence |
GCATCCATGGCTGAATGGTTAAAGCGCCCAACTCATAATTGGCGAATTCGTAGGTTCAAT |
Downstream region at tRNA end position |
cccaaatggg |
Secondary structure (Cloverleaf model) | >CHL1810032228 Met CAT a ACgc cccaaatggg G - C C - G A - T T - A C - G C - G A - T T T T C A T C C A T A A G | | | | | A G G T C G G T A G G C G | | | T T T A A G C T A G GAATTC C C C - G C - G A - T A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |