| Sequence ID | >CHL1810032898 |
| Genome ID | KX343072 |
| Phylum/Class | Viridiplantae |
| Species | Cakile arabica (KX343072) |
| Start position on genome | 35783 |
| End posion on genome | 35854 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
gcaaaaaaat |
| tRNA gene sequence |
GCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
atagaaatgg |
| Secondary structure (Cloverleaf model) | >CHL1810032898 Gly GCC
t CCaa atagaaatgg
G - C
C - G
G - C
G - C
A - T
T - A
A - T T T
T C G C C C A
A A A | | | | | G
T G C T G G C G G G C
G | + T T
G A A A T
T A T AGAC
T - A
C - G
T - A
C - G
T + G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |