Sequence ID | >CHL1810033708 |
Genome ID | KX447140 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Rhus chinensis (KX447140) |
Start position on genome | 43916 |
End posion on genome | 43989 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gaatcaaatA |
tRNA gene sequence |
GCCCTTTTAACTCAGTGGTAGAGTAACGCCATGGTAAGGCGTAAGTCATCGGTTCAAATC |
Downstream region at tRNA end position |
gcctttttca |
Secondary structure (Cloverleaf model) | >CHL1810033708 Thr GGT A TTtg gcctttttca G - C C - G C - G C - G T + G T - A T - A T A T T A G C C A G A A | | | | | A T C T C A A T C G G C G | | | | T T G G A G T T A A AAGTC A - T C - G G - C C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |