Sequence ID | >CHL1810034194 |
Genome ID | KX579943 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Ulva flexuosa (KX579943) |
Start position on genome | 89219 |
End posion on genome | 89147 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tataaaaaaA |
tRNA gene sequence |
GCGGAGTTCGTATAGTGGTAATACCTCAGCCTTCCAAGCTGAAGCGAGGGGTTCGATTCC |
Downstream region at tRNA end position |
tcatatatta |
Secondary structure (Cloverleaf model) | >CHL1810034194 Gly TCC A TAat tcatatatta G - C C - G G - C G - C A - T G - C T - A T T T T C C C C A G A C | | | | | G T T A T G A G G G G C G | | | | T T G A T A C T A C AGCG T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |