| Sequence ID | >CHL1810036824 |
| Genome ID | KX826832 |
| Phylum/Class | Viridiplantae |
| Species | Salpinga maranonensis (KX826832) |
| Start position on genome | 36189 |
| End posion on genome | 36097 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
attcgattgt |
| tRNA gene sequence |
GGAGAGATGGCCGAGTGGTTGATGGTTCCGGTCTTGAAAACCGGTATAGTTTTTAACAAA |
| Downstream region at tRNA end position |
gctcattctt |
| Secondary structure (Cloverleaf model) | >CHL1810036824 Ser TGA
t Tttt gctcattctt
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C T C C C A
T G A G | | | | | G
G G C C G G A G G G C
G + | | + T T
T T G G T
T G A T TATAGTTTTTAACAAAGAATTATC
C - G
C - G
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |