Sequence ID | >CHL1810036904 |
Genome ID | KX827312 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Ludwigia octovalvis (KX827312) |
Start position on genome | 71970 |
End posion on genome | 71895 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
accaattgaa |
tRNA gene sequence |
AGGGATGTAGCGCAGCTTGGTAGCGCGTTTGTTTTGGGTACAAAATGTCACGGGTTCAAA |
Downstream region at tRNA end position |
attacttctc |
Secondary structure (Cloverleaf model) | >CHL1810036904 Pro TGG a ACCt attacttctc A - T G - C G - C G - C A - T T - A G - C T A T T G T C C A C G A A | | + | | A T C G C G A C G G G C T | | | | T T G G C G C G T A G ATGTC T - A T - A T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |