| Sequence ID | >CHL1810039892 |
| Genome ID | KY200671 |
| Phylum/Class | Viridiplantae |
| Species | Decaisnea insignis (KY200671) |
| Start position on genome | 32663 |
| End posion on genome | 32578 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
gattcttccT |
| tRNA gene sequence |
GGGTCGATGCCCGAGTGGTTAATGGGGACGGACTGTAAATTCGTTGGCAATATGTCTACG |
| Downstream region at tRNA end position |
attcgccgat |
| Secondary structure (Cloverleaf model) | >CHL1810039892 Tyr GTA
T AAta attcgccgat
G - C
G - C
G - C
T + G
C - G
G - C
A - T T A
T C G A C C A
T G A G | | | | | A
G G C C C G C T G G C
G + | | | T T
T T G G G
T A A G TGGCAATATGTCTAC
A - T
C - G
G - C
G + T
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |