| Sequence ID | >CHL1810040595 | 
| Genome ID | KY401426 | 
| Phylum/Class | Viridiplantae | 
| Species | Amana kuocangshanica (KY401426) | 
| Start position on genome | 9561 | 
| End posion on genome | 9632 | 
| Amino Acid | Arg | 
| Anticodon | TCT | 
| Upstream region at tRNA start position | ggaatgaaaa | 
| tRNA gene sequence | GCGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTGGTATAGGTTCAAATC | 
| Downstream region at tRNA end position | tatttccatc | 
| Secondary structure (Cloverleaf model) | >CHL1810040595	Arg	TCT
                   a      Aatt tatttccatc
                     G - C
                     C - G
                     G - C
                     T - A
                     C - G
                     C - G
                     A - T          T A
                    T     T A T C C     A
      T A A        T      | | | | |     A
    G       T C T G       A T A G G     C
    G       + | | |                 T T
    A       G G A C
      T A          A     TGGT
                    G + T
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    T C T
 | 
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] | 
| Comment | |
| --- | |
| Input Comment |