Sequence ID | >CHL1810040637 |
Genome ID | KY407561 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Aconitum longecassidatum (KY407561) |
Start position on genome | 139626 |
End posion on genome | 139555 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ggggcaggga |
tRNA gene sequence |
AGGGATATAACTCAGCGGTAGAGTGTCACCTTGACGTGGTGGAAGTCATCAGTTCGAGCC |
Downstream region at tRNA end position |
ccaatgtgag |
Secondary structure (Cloverleaf model) | >CHL1810040637 Val GAC a Aaat ccaatgtgag A - T G - C G - C G - C A - T T - A A - T C G T T A G T C A G A A | | | | | G C C T C A A T C A G C G | | | | T T G G A G T T A G AAGTC T + G C - G A - T C - G C - G T T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |