Sequence ID | >CHL1810040814 |
Genome ID | KY407660 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Neodangemannia microcystis (KY407660) |
Start position on genome | 512 |
End posion on genome | 430 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttacatataT |
tRNA gene sequence |
GCTCTCCTGGTGGAATTGGTAGACACGCTGGTCTTAGGAACCAGTGCCTTGTGTGTGAGG |
Downstream region at tRNA end position |
agatcaaaat |
Secondary structure (Cloverleaf model) | >CHL1810040814 Leu TAG T AAtt agatcaaaat G - C C - G T - A C - G T - A C - G C - G T G T C T C C C A T A A G | | | | | G T G G T G G A G G G C G | | | T T G A C A C T A G G TGCCTTGTGTGT C - G T - A G - C G - C T - A C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |