Sequence ID | >CHL1810041009 |
Genome ID | KY419137 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Acer buergerianum (KY419137) |
Start position on genome | 30804 |
End posion on genome | 30728 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttatttatcC |
tRNA gene sequence |
GGGATTGTAGTTCAATTGGTCAGAGCACCGCCCTGTCAAGGCGGAAGCTGCGGGTTCGAG |
Downstream region at tRNA end position |
gatccaaatc |
Secondary structure (Cloverleaf model) | >CHL1810041009 Asp GTC C GACg gatccaaatc G - C G - C G - C A - T T + G T - A G - C C G T T G C C C A T A A A + | | | | G T C T T G G C G G G C G | | + | T T G G A G C T C A A AAGCT C - G C - G G - C C - G C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |