| Sequence ID | >CHL1810041793 |
| Genome ID | KY427357 |
| Phylum/Class | Viridiplantae |
| Species | Stegnogramma sagittifolia (KY427357) |
| Start position on genome | 109734 |
| End posion on genome | 109661 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
acaaatctaa |
| tRNA gene sequence |
CGGAATGTGGCGCAGTTTGGTAGCGCGCCATCTTGGGGTGATGGAGGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
gagataaagt |
| Secondary structure (Cloverleaf model) | >CHL1810041793 Pro GGG
a Aatg gagataaagt
C - G
G - C
G - C
A - T
A - T
T - A
G + T T A
T C G T C C A
T G A G | | | | | G
T C G C G G C A G G C
T | | | | T T
G G C G C
G T A G AGGTC
C - G
C - G
A - T
T - A
C - G
T T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |