Sequence ID | >CHL1810042170 |
Genome ID | KY432788 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Nassella hyalina (KY432788) |
Start position on genome | 15853 |
End posion on genome | 15938 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aattcttccT |
tRNA gene sequence |
GGGTCGATGCCCGAGCGGTTAATGGGGACGGACTGTAAATTCGTTGACAATATGTCTACG |
Downstream region at tRNA end position |
atctagggct |
Secondary structure (Cloverleaf model) | >CHL1810042170 Tyr GTA T AAaa atctagggct G - C G - C G - C T + G C - G G - C A - T T A T C G A C C A C G A G | | | | | A G G C C C G C T G G C G + | | | T T T T G G G T A A G TGACAATATGTCTAC A - T C - G G - C G + T A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |