Sequence ID | >CHL1810042490 |
Genome ID | KY432800 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Trichoneura grandiglumis (KY432800) |
Start position on genome | 44288 |
End posion on genome | 44374 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aagttatgta |
tRNA gene sequence |
GGAGAGATGGCCGAGCGGTTCAAGGCGTAGCATTGGAACTGCTATGTAGACTTTTGTTTA |
Downstream region at tRNA end position |
ctcttaattc |
Secondary structure (Cloverleaf model) | >CHL1810042490 Ser GGA a Gttt ctcttaattc G - C G - C A - T G + T A - T G - C A - T T A T C T C C C A C G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C T C A G TGTAGACTTTTGTTTACC T - A A - T G - C C - G A - T T C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |