Sequence ID | >CHL1810044075 |
Genome ID | KY596164 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Andropogon burmanicus (KY596164) |
Start position on genome | 134579 |
End posion on genome | 134661 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctttcaagaT |
tRNA gene sequence |
GCCTTGATGGTGAAATGGTAGACACGCGAGACTCAAAATCTCGTGCTAAAGAGCGTGGAG |
Downstream region at tRNA end position |
tacggagaat |
Secondary structure (Cloverleaf model) | >CHL1810044075 Leu CAA T ATaa tacggagaat G - C C - G C - G T - A T - A G - C A - T T G T T C T C C A T A A G + | | | | G G A G T G G G A G G C G | | | T T T A C A C A G G TGCTAAAGAGCGT C - G G - C A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |