| Sequence ID | >CHL1810044207 |
| Genome ID | KY596171 |
| Phylum/Class | Viridiplantae |
| Species | Garnotia thailandica (KY596171) |
| Start position on genome | 6875 |
| End posion on genome | 6804 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
cgaaataaaa |
| tRNA gene sequence |
TGGGGCGTGGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGTTACTCGGAGGTTCGAATC |
| Downstream region at tRNA end position |
ttttctgatg |
| Secondary structure (Cloverleaf model) | >CHL1810044207 Gln TTG
a Gatt ttttctgatg
T - A
G - C
G - C
G - C
G + T
C - G
G - C T A
T C T T C C A
G A G | + | | | G
T A C C G G G A G G C
G | | | T T
G A G G C
T A A TACTC
G + T
C - G
G - C
G - C
G - C
T T
T G
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |