Sequence ID | >CHL1810044213 |
Genome ID | KY596172 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Schizachyrium tenerum (KY596172) |
Start position on genome | 48316 |
End posion on genome | 48389 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
acaagaaagg |
tRNA gene sequence |
GTCAGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCAGTTCAAAT |
Downstream region at tRNA end position |
aaaaaaagga |
Secondary structure (Cloverleaf model) | >CHL1810044213 Phe GAA g ACag aaaaaaagga G - C T + G C - G A - T G - C G - C A - T T A T T G G T C A T G A A | | | | | A T C T C G A C C A G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |