Sequence ID | >CHL1810045166 |
Genome ID | KY709209 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Bulboplastis apyrenoidosa NIES-2742 (KY709209) |
Start position on genome | 57469 |
End posion on genome | 57541 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agtgataatg |
tRNA gene sequence |
GCGAGCGTAGCCAAATGGTAAGGCAGTGGATTGTGGCTCCTCTATTCGCGGGTTCGATTC |
Downstream region at tRNA end position |
aaaaatatac |
Secondary structure (Cloverleaf model) | >CHL1810045166 His GTG g CCtt aaaaatatac G - C C - G G - C A - T G + T C - G G - C T T T T G C C C A A A A + | | | | G T A C C G G C G G G C G | | | T T G A G G C T A A TATTC G - C T T G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |