Sequence ID | >CHL1810045867 |
Genome ID | KY819065 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Rhipilia penicilloides (KY819065) |
Start position on genome | 24602 |
End posion on genome | 24522 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ggcaattttg |
tRNA gene sequence |
GCTCTTGTGACGAAATTGGTAGACGTGTTAGTTTTAGGAACTAATGTCTTTGACATATGG |
Downstream region at tRNA end position |
gaaaagtgga |
Secondary structure (Cloverleaf model) | >CHL1810045867 Leu TAG g Attc gaaaagtgga G - C C - G T - A C - G T - A T - A G - C T G T T T C C C A T A A G | | | | G T A G C A A T G G G C G | | | T T G A C G T T A G G TGTCTTTGACAT T - A T - A A - T G - C T - A T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |