Sequence ID | >CHL1810046107 |
Genome ID | KY859413 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Koelreuteria paniculata (KY859413) |
Start position on genome | 51094 |
End posion on genome | 51020 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tgttatttaA |
tRNA gene sequence |
GCCCGCTTAGCTCAGAGGTTAGAGCATCGCATTTGTAATGCGATGGTCATCGGTTCGATT |
Downstream region at tRNA end position |
atctacttat |
Secondary structure (Cloverleaf model) | >CHL1810046107 Thr TGT A TTtt atctacttat G - C C - G C - G C C G - C C - G T - A T T T T A G C C A A G A A | | | | | G G C T C G A T C G G C G | | | | T T T G A G C T A A TGGTC T - A C - G G - C C - G A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |