| Sequence ID | >CHL1810046775 |
| Genome ID | LC008447 |
| Phylum/Class | Alveolata |
| Species | Lepidodinium chlorophorum (LC008447) |
| Start position on genome | 36053 |
| End posion on genome | 36138 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
aaagcaagtg |
| tRNA gene sequence |
GGAGTAGTGGCTGAGTGGTTTAAAGCGTTAGTTTCGAAAACTGATTTGAATCTTATTCAA |
| Downstream region at tRNA end position |
cagggtgcat |
| Secondary structure (Cloverleaf model) | >CHL1810046775 Ser CGA
g Atat cagggtgcat
G - C
G - C
A - T
G - C
T T
A - T
G - C T A
T T T C C C A
T G A G | | | | | A
G G T C G A A G G G C
G | | | T T
T A A G C
T T A G TTTGAATCTTATTCAAC
T - A
T + G
A - T
G - C
T - A
T A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |