Sequence ID | >CHL1810046833 |
Genome ID | LC049070 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Dioon spinulosum (LC049070) |
Start position on genome | 118695 |
End posion on genome | 118622 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gtcgttacaa |
tRNA gene sequence |
CGGGGCATGGCGTAGCTTGGTAGCGTGCCATCTTGGGGTGGTGGAGGTCGTGGGTTCAAA |
Downstream region at tRNA end position |
ggaatgaaga |
Secondary structure (Cloverleaf model) | >CHL1810046833 Pro GGG a Aagc ggaatgaaga C - G G - C G - C G + T G - C C - G A - T T A T C G C C C A C G A G | + | | | A T T G C G G T G G G C T + | | + T T G G C G T G T A G AGGTC C - G C - G A - T T + G C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |