Sequence ID | >CHL1810050085 |
Genome ID | MF101423 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Polysiphonia sertularioides (MF101423) |
Start position on genome | 156793 |
End posion on genome | 156720 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttcattataT |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAGCGGACTTTGACTCCGCCATTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
aaaaacaaaa |
Secondary structure (Cloverleaf model) | >CHL1810050085 Gln TTG T GAtt aaaaacaaaa T - A G - C G - C G - C G - C T - A G + T T A T C C T C C A G A A | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATTC G - C C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |