Sequence ID | >CHL1810050122 |
Genome ID | MF101424 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Rhodomela confervoides (MF101424) |
Start position on genome | 29745 |
End posion on genome | 29673 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cataacaaaa |
tRNA gene sequence |
GGGCTTATCGTCTAAGGGATAAGGACAGGGACCTTCTAAGTCTCTAATGTAGGTTCGAAT |
Downstream region at tRNA end position |
aattatcaat |
Secondary structure (Cloverleaf model) | >CHL1810050122 Arg TCT a Atga aattatcaat G + T G - C G - C C - G T - A T - A A - T T A T C A T C C A G A A C | | | | | G G T C T G G T A G G C G + | | | T T A G G A C T A A A TAAT G - C G + T G - C A - T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |