Sequence ID | >CHL1810050204 |
Genome ID | MF101428 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Polysiphonia stricta (MF101428) |
Start position on genome | 54344 |
End posion on genome | 54416 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttttagtaaa |
tRNA gene sequence |
GGGCATGTAACTCAGTGGATAGAGTGCCAAATTCCGACTTTGGTGGTCGAAGGTTCAAAT |
Downstream region at tRNA end position |
ttaatttagt |
Secondary structure (Cloverleaf model) | >CHL1810050204 Arg CCG a Atat ttaatttagt G + T G - C G - C C - G A - T T T G - C T A T C T T C C A T G A A | | | | | A G C T C A G A A G G C G | | | | T T A G A G T T A G TGGTC C - G C - G A - T A - T A - T T C T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |