Sequence ID | >CHL1810050244 |
Genome ID | MF101430 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Bryothamnion seaforthii (MF101430) |
Start position on genome | 111829 |
End posion on genome | 111754 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taataatgtT |
tRNA gene sequence |
CGCGGGGTAGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCAGTGGTTCAAA |
Downstream region at tRNA end position |
aactatcgtt |
Secondary structure (Cloverleaf model) | >CHL1810050244 Met CAT T ATta aactatcgtt C T G - C C - G G - C G - C G - C G - C T A T T T A C C A T G A A | + | | | A C C G A G A G T G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |