Sequence ID | >CHL1810050553 |
Genome ID | MF101445 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Sonderella linearis (MF101445) |
Start position on genome | 1544 |
End posion on genome | 1617 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaattaaata |
tRNA gene sequence |
GGGCTATTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAAGTCCCTGGTTCAAA |
Downstream region at tRNA end position |
agagggggta |
Secondary structure (Cloverleaf model) | >CHL1810050553 Ile GAT a Agat agagggggta G - C G - C G - C C - G T - A A - T T - A T A T G G A C C A T G A A | | | | | A T C T C G C C T G G C G | | | | T T G G A G C T T A G AAGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |