Sequence ID | >CHL1810050557 |
Genome ID | MF101445 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Sonderella linearis (MF101445) |
Start position on genome | 54441 |
End posion on genome | 54515 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aataatataT |
tRNA gene sequence |
GGGCATGTAACTCAGCGGATAGAGTACCAAATTCCGACTTTGGTTGTCGAAGGTTCAAAT |
Downstream region at tRNA end position |
agtttttgat |
Secondary structure (Cloverleaf model) | >CHL1810050557 Arg CCG T ATta agtttttgat G - C G + T G - C C - G A - T T T G - C T A T C T T C C A C G A A | | | | | A G C T C A G A A G G C G | | | | T T A G A G T T A A TTGTC C - G C - G A - T A - T A - T T C T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |