Sequence ID | >CHL1810050698 |
Genome ID | MF101450 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Cliftonaea pectinata (MF101450) |
Start position on genome | 73590 |
End posion on genome | 73509 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgagttatag |
tRNA gene sequence |
GGGTAGATGGCGAAATTGGTATACGCATCACATTCAAAATGTGATAACTTTAGTTATGAG |
Downstream region at tRNA end position |
aaattaatat |
Secondary structure (Cloverleaf model) | >CHL1810050698 Leu CAA g Atag aaattaatat G - C G - C G - C T - A A - T G - C A - T T A T C T C C C A T A A G | | | | | A T A G C G G A G G G C G | | | T T G A C G C T A T A TAACTTTAGTTAT T - A C - G A - T C - G A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |