| Sequence ID | >CHL1810052211 |
| Genome ID | MF357889 |
| Phylum/Class | Viridiplantae |
| Species | Citrullus colocynthis (MF357889) |
| Start position on genome | 38467 |
| End posion on genome | 38538 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
aaaaaaaaat |
| tRNA gene sequence |
GCGGATATAGTTGAATGGTAAAATTTCTCCTTGCCAAGGAGAAGATGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
gatgaggata |
| Secondary structure (Cloverleaf model) | >CHL1810052211 Gly GCC
t CCag gatgaggata
G - C
C - G
G - C
G - C
A - T
T - A
A - T T T
T C G C C C A
A A A | | | | | G
T G T T G G C G G G C
G | | + T T
G A A A T
T A T AGAT
T - A
C - G
T - A
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |