| Sequence ID | >CHL1810052657 |
| Genome ID | MF460976 |
| Phylum/Class | Viridiplantae |
| Species | Agrostis gigantea (MF460976) |
| Start position on genome | 18225 |
| End posion on genome | 18155 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
cggatttttt |
| tRNA gene sequence |
GGCGGCATGGCCAAGCGGTAAGGCAGGGGACTGCAAATCCTTTATCCCCAGTTCAAATCT |
| Downstream region at tRNA end position |
caataaaata |
| Secondary structure (Cloverleaf model) | >CHL1810052657 Cys GCA
t Tgat caataaaata
G - C
G - C
C - G
G - C
G - C
C - G
A - T T A
T G G G T C A
G A G | | | | | A
C A C C G C C C A G C
G | | | T T
G A G G C
T A A TATC
G + T
G + T
G - C
G - C
A - T
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |