Sequence ID | >CHL1810052820 |
Genome ID | MF460982 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Lamarckia aurea (MF460982) |
Start position on genome | 132225 |
End posion on genome | 132299 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccctgttaa |
tRNA gene sequence |
GCATCCATGGCTGAATGGTTAAAGCGCCCAACTCATAATTGGTAAATTTGCGGGTTCAAT |
Downstream region at tRNA end position |
gaacgggaac |
Secondary structure (Cloverleaf model) | >CHL1810052820 Met CAT a ACac gaacgggaac G - C C - G A - T T - A C - G C - G A - T T T T C G T C C A T A A G | | + | | A G G T C G G C G G G C G | | | T T T A A G C T A G AAATTT C T C - G C - G A - T A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |