Sequence ID | >CHL1810052996 |
Genome ID | MF490441 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Echinacanthus lofouensis (MF490441) |
Start position on genome | 65601 |
End posion on genome | 65528 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgataagaaa |
tRNA gene sequence |
GCGCTCTTAGTTCAGTTCGGTAGAACGTGGGTCTCCAAAACCCGATGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
ttttcttcgt |
Secondary structure (Cloverleaf model) | >CHL1810052996 Trp CCA a Gatt ttttcttcgt G + T C - G G - C C - G T - A C - G T - A T A T C A T C C A T G A A | | | | | A T C T T G G T A G G C C | | | | T T G G A A C G T A G ATGTC T + G G - C G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |