Sequence ID | >CHL1810053042 |
Genome ID | MF536694 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Citrullus amarus (MF536694) |
Start position on genome | 132365 |
End posion on genome | 132438 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttaccgttgT |
tRNA gene sequence |
TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tgattcattc |
Secondary structure (Cloverleaf model) | >CHL1810053042 Asn GTT T GAtt tgattcattc T - A C - G C - G T + G C - G A - T G + T T A T C A T C C A G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A G TGGTC G + T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |