Sequence ID | >CHL1810059266 |
Genome ID | MG755792 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Plagiogramma staurophorum (MG755792) |
Start position on genome | 6875 |
End posion on genome | 6802 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
attactagaT |
tRNA gene sequence |
GGGTAATTAACTCAGTGGTAGAGTGTCTGCCTTACAAGCAGAAGGTCACAGGTTCAAATC |
Downstream region at tRNA end position |
agattaaggc |
Secondary structure (Cloverleaf model) | >CHL1810059266 Val TAC T ATat agattaaggc G - C G - C G - C T - A A - T A - T T - A T A T T G T C C A G A A | | | | | A T C T C A A C A G G C G | | | | T T G G A G T T A G AGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |