Sequence ID | >CHL1810059287 |
Genome ID | MG755793 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Rhizosolenia setigera (MG755793) |
Start position on genome | 95494 |
End posion on genome | 95421 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
attattttcg |
tRNA gene sequence |
GCGAGCGTGGCCAAGTGGTTAAGGCAGTGGGTTGTGGTTCCACCATTCGTCGGTTCAAGT |
Downstream region at tRNA end position |
ttagaatgtt |
Secondary structure (Cloverleaf model) | >CHL1810059287 His GTG g CCta ttagaatgtt G - C C - G G - C A - T G + T C - G G - C T G T T A G C C A T G A G + | | | | A G A C C G G T C G G C G | | | T T T A G G C T A A CATTC G - C T - A G - C G - C G + T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |