Sequence ID | >CHL1810059362 |
Genome ID | MG755798 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Attheya longicornis (MG755798) |
Start position on genome | 70712 |
End posion on genome | 70785 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaaactcaaa |
tRNA gene sequence |
GGGCTATTAGCTCAGTTGGTTAGAGCGCGCCCCTGATAAGGGCGAGGTCTCTGGTTCAAA |
Downstream region at tRNA end position |
ggggtatagc |
Secondary structure (Cloverleaf model) | >CHL1810059362 Ile GAT a Aacg ggggtatagc G - C G - C G - C C - G T + G A - T T - A T A T A G A C C A T G A A | | | | | A T C T C G T C T G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |