Sequence ID | >CHL1810059637 |
Genome ID | MG755808 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Acanthoceras zachariasii (MG755808) |
Start position on genome | 83452 |
End posion on genome | 83523 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaggcatata |
tRNA gene sequence |
TCCTCAATAGCTCAGCGGTAGAGCAATCGGCTGTTAACCGATTGGTCGTAGGTTCAAATC |
Downstream region at tRNA end position |
ataaaaaaat |
Secondary structure (Cloverleaf model) | >CHL1810059637 Asn GTT a Gtaa ataaaaaaat T - A C - G C - G T + G C - G A - T A - T T A T C A T C C A G A A | | | | | A C C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC A - T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |