Sequence ID | >CHL1830001072 |
Genome ID | KT625421 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Bracteacoccus giganteus (KT625421) |
Start position on genome | 233817 |
End posion on genome | 233741 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
agtgcatcac |
tRNA gene sequence |
GGACCATTAGCTCAGTCGGTTAGAGCGTACGCTTGATAAGCGTAAGGTCGTTGATTCAAG |
Downstream region at tRNA end position |
attctatttc |
Secondary structure (Cloverleaf model) | >CHL1830001072 Ile GAT c ACCA attctatttc G - C G - C A - T C - G C - G A - T T - A T G T C A A C T A T G A A | | | | | A C C T C G G T T G A C G | | | | T T G G A G C T T A G AGGTC T - A A - T C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |