Sequence ID | >CHL1830001692 |
Genome ID | KY100263 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Vachellia flava (KY100263) |
Start position on genome | 36969 |
End posion on genome | 36895 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gggcaagtaT |
tRNA gene sequence |
GCCCCCATCGTCTAGTGGTTCAGGACATCTCTCTTTCAAGGAGGCAGCGGGGATTCGACT |
Downstream region at tRNA end position |
ttagggtata |
Secondary structure (Cloverleaf model) | >CHL1830001692 Glu TTC T AGgg ttagggtata G + T C - G C - G C - G C - G C - G A - T T C T C C C C T A T G A C | | | | | G G T C T G G G G G A C G + | | | T T T G G A C T C A A CAGC T + G C - G T - A C - G T + G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |