Sequence ID | >CHL1830002166 |
Genome ID | MF101419 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Bostrychia moritziana (MF101419) |
Start position on genome | 163953 |
End posion on genome | 163878 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttaatataaT |
tRNA gene sequence |
GGGCTTGTAGCTCAGTGGATTAGAGCACGTGGCTACGAACCACGGTGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
caaattataa |
Secondary structure (Cloverleaf model) | >CHL1830002166 Arg ACG T GAta caaattataa G + T G - C G - C C - G T T T T G - C T G T C T C C C A T G A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T T A A GTGTC C - G G - C T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |