Sequence ID | >CHL1830002238 |
Genome ID | MF101454 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Polysiphonia schneideri (MF101454) |
Start position on genome | 33011 |
End posion on genome | 32937 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
atattttagT |
tRNA gene sequence |
GCCCCCATCGTCTAGAGGCCTAGGACATCTCCCTTTCACGGAGGTAACGGGGATTCGAAT |
Downstream region at tRNA end position |
aagagtaaaa |
Secondary structure (Cloverleaf model) | >CHL1830002238 Glu TTC T AAtt aagagtaaaa G + T C - G C - G C - G C - G C - G A - T T A T C C C C T A A G A C | | | | | G G T C T G G G G G A C G + | | | T T C G G A C C T A A TAAC T + G C - G T - A C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |