Sequence ID | >C183000523 |
Genome ID | CP018092 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Thermostichus lividus PCC 6715 [CP018092] |
Start position on genome | 1184472 |
End posion on genome | 1184396 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gctgcgtctT |
tRNA gene sequence |
GCCCCCATCGTCTAGAGGCCTAGGACACCTCCCTTTCACGGAGGCGACGGGGATTCGAAT |
Downstream region at tRNA end position |
cacaatggca |
Secondary structure (Cloverleaf model) | >C183000523 Glu TTC T ATCC cacaatggca G + T C - G C - G C - G C - G C - G A - T T A T C C C C T A A G A C | | | | | G G T C T G G G G G A C G + | | | T T C G G A C C T A A CGAC C - G C - G T - A C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |