Sequence ID | >W09134328 |
Genome ID | ACSF01000002 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Helicobacter canadensis MIT 98-5491(ACSF) [ACSF] |
Start position on genome | 142844 |
End posion on genome | 142928 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttataattgg |
tRNA gene sequence |
GGTGAGATACTCAAGTGGCCAACGAGGGCAGACTGTAAATCTGCTGGTTCTACCTTCCGT |
Downstream region at tRNA end position |
ttaatagcta |
Secondary structure (Cloverleaf model) | >W09134328 Tyr GTA g ACCA ttaatagcta G - C G - C T - A G - C A - T G - C A - T T A T G C A C C A T G A A | | | | | G G A C T C C G T G G C G | | | T T C C G A G C A A G TGGTTCTACCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |