| Sequence ID | >C181000516 |
| Genome ID | AP014836 |
| Phylum/Class | Gammaproteobacteria |
| Species | Candidatus Nitrosoglobus terrae TAO100 [AP014836] |
| Start position on genome | 1529492 |
| End posion on genome | 1529400 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
taaacctcct |
| tRNA gene sequence |
GGAGAGATGGCCGAGAGGCTGAAGGCGCTCCCCTGCTAAGGGAGTATGGGGTTAATAGCT |
| Downstream region at tRNA end position |
ttaccgctat |
| Secondary structure (Cloverleaf model) | >C181000516 Ser GCT
t GCCA ttaccgctat
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C T C C C A
A G A G | | | | | G
G G C C G G A G G G C
G | | | T T
C A G G C
T G A G TATGGGGTTAATAGCTCCATC
C - G
T - A
C - G
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |