Sequence ID | >W141491342 |
Genome ID | JGCE01000005 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Acinetobacter baumannii 25681_8 [JGCE] |
Start position on genome | 34921 |
End posion on genome | 34995 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
catcgaattt |
tRNA gene sequence |
AGGGGCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGATCCCGCCATCCGTTGGTTCGAATC |
Downstream region at tRNA end position |
ttctcttatt |
Secondary structure (Cloverleaf model) | >W141491342 Gln TTG t GCCA ttctcttatt A - T G - C G - C G - C G - C C - G G - C T A T C G A C C A G A C | + | | | G T A C C G G T T G G C G | | | T T G A G G C T A A CATCC G - C C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |