Sequence ID | >C181002073 |
Genome ID | AP017459 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Candidatus Endomicrobium trichonymphae Rs-D17 [AP017459] |
Start position on genome | 338617 |
End posion on genome | 338687 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ctataaattt |
tRNA gene sequence |
GCGGGAGTAGCACAATGGTAGTGCTCCAGCCTTCCAAGCTGTCCACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
tacttattgt |
Secondary structure (Cloverleaf model) | >C181002073 Gly TCC t Tttt tacttattgt G - C C - G G - C G - C G - C A - T G - C T T T T G C C C A A A A + | | | | G T C A C G G C G G G C G | | | | T T G G T G C T A T CCAC C T C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |