Sequence ID | >C181002103 |
Genome ID | AP017459 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Candidatus Endomicrobium trichonymphae Rs-D17 [AP017459] |
Start position on genome | 302826 |
End posion on genome | 302743 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tgcgcataaa |
tRNA gene sequence |
GCTGAGGTGGTGGAACGGCAGACACGCAGGTCTCAGAAGCCTGTCCCCGAAAGGGCGGTA |
Downstream region at tRNA end position |
ttttactttg |
Secondary structure (Cloverleaf model) | >C181002103 Leu CAG a Atat ttttactttg G - C C - G T - A G - C A - T G - C G - C T A T T C C C C A C A A G | | | | | G G G G T G A G G G G C G | | | T T C A C A C A G G TCCCCGAAAGGGCGGT C - G A - T G - C G - C T + G C A T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |