Sequence ID | >C181003129 |
Genome ID | AP017649 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi UCH-ATV1 [AP017649] |
Start position on genome | 652121 |
End posion on genome | 652207 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcttaaaccg |
tRNA gene sequence |
GCCGAAGTGGCGGAATGGCAGACGCGGCAGTCTCAAACACTGCTGGGGGTAAACCTCGTG |
Downstream region at tRNA end position |
agaggacttg |
Secondary structure (Cloverleaf model) | >C181003129 Leu CAA g ACCA agaggacttg G - C C - G C - G G - C A - T A - T G - C T G T C A G C C A T A A G | | | | | G G G G C G G T C G G C G | | | T T C A C G C A G G TGGGGGTAAACCTCGT G - C C - G A - T G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |