Sequence ID | >C181008346 |
Genome ID | CP010518 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Pandoraea apista TF81F4 [CP010518] |
Start position on genome | 531039 |
End posion on genome | 531114 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gatcacggcg |
tRNA gene sequence |
GTGGCCGTAGCTCAGTTGGTAGAGTCCTGGATTGTGATTCCAGTCGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
aaattcccct |
Secondary structure (Cloverleaf model) | >C181008346 His GTG g CCCA aaattcccct G - C T - A G - C G + T C - G C - G G - C T G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | + T T G G A G T T A C TCGTC C - G T - A G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |